Gene name |
SPAC458.05 |
Gene ID |
28/F06 |
Gene synonyms/obsolete |
vps34 |
Gene product |
phosphatidylinositol
3-kinase; involved in stress response (implicated); class D
vps; essential; involved in cell growth (required); involved
in vacuole organization and biogenesis; involved in
sporulation; involved in conjugation; involved in prospore
membrane formation |
Entry clone |
Cloned |
ORF length (unspliced) |
2406 |
ORF length (spliced) |
|
Entry clone length |
2406 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1522T:C / 2262T:G /
2340T:G / 2384T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC458.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAGACTTGTTTTTTC |
Rev primer name |
SPAC458.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGATCGCATATACTGCGCA |
Amino acid length |
801 |
Molecular weight |
92.1 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDGLLLKLQL/LVTIPILYL/LLDFHALPL |
Localization (YFP) |
cytoplasmic dots;
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |