| Gene name |
SPAC17A5.06 |
| Gene ID |
28/F10 |
| Gene synonyms/obsolete |
ercc3sp |
| Gene product |
DEAD box helicase;
involved in DNA repair; ERCC-3 complementing; putative TFIIH
subunit; XP-B family; helicase C-terminal domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2415 |
| ORF length (spliced) |
|
| Entry clone length |
2415 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
277A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17A5.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCTAAAGAGAAAAAA |
| Rev primer name |
SPAC17A5.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGACGTTTAGTATACAGG |
| Amino acid length |
804 |
| Molecular weight |
91.3 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRDPVIGPLRI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |