| Gene name |
SPBP8B7.27 |
| Gene ID |
28/H03 |
| Gene synonyms/obsolete |
|
| Gene product |
ubiquitin-protein
ligase (E3); HECT domain; zinc finger protein; zf-UBP
type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2468 |
| ORF length (spliced) |
2424 |
| Entry clone length |
2468 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.27.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCGCCCTATTGAAAT |
| Rev primer name |
SPBP8B7.27.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGTATATTGAACCCATTA |
| Amino acid length |
807 |
| Molecular weight |
93.4 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYHDITNLDI/LYRGLKELLL |
| Localization (YFP) |
SPB; periphery at cell
tip and site of septum formation; nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |