| Gene name |
SPAC6F12.01 |
| Gene ID |
29/A12 |
| Gene synonyms/obsolete |
SPAC1565.08 |
| Gene product |
AAA family ATPase;
Cdc48-Ufd1-Npl4 complex component (putative); involved in
ubiquitin-dependent proteolysis; involved in proteasomal
processing; involved in the recognition of
polyubiquitin-tagged proteins; transitional ER ATPase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2504 |
| ORF length (spliced) |
2448 |
| Entry clone length |
2504 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
656A:G / 1226T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F12.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACGCACCATCCACCAT |
| Rev primer name |
SPAC6F12.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCATACAAATCATCAGCA |
| Amino acid length |
815 |
| Molecular weight |
90.1 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
36 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |