Gene name |
SPCC622.10c |
Gene ID |
29/B08 |
Gene synonyms/obsolete |
|
Gene product |
sequence orphan;
hypothetical protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2514 |
ORF length (spliced) |
2448 |
Entry clone length |
2514 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
843A:G / 1379A:G /
1950T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC622.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGCAGACGAAGAGAT |
Rev primer name |
SPCC622.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGAAAAGATCATTTCAATA |
Amino acid length |
815 |
Molecular weight |
92.7 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRELNKLYI/LHFVTRLLNL/LQDLYKLLAI |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |