Gene name |
SPAC513.01c |
Gene ID |
29/C05 |
Gene synonyms/obsolete |
eft201; eft2; eft2-1;
SPAPYUK71.04c |
Gene product |
elongation factor 2;
similar to Sp SPCP31B10.07 |
Entry clone |
Cloned |
ORF length (unspliced) |
2529 |
ORF length (spliced) |
|
Entry clone length |
2529 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
6C:T / 15A:T /
2524T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC513.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTGCGTTCACTCCTGA |
Rev primer name |
SPAC513.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGGCGGTCATAATATTCA |
Amino acid length |
842 |
Molecular weight |
93.2 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMEMIVLHL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |