Gene name |
SPAC1B3.13 |
Gene ID |
29/D06 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein;
involved in the regulation of nucleolar silencing; involved in
the regulation of the telophase exist (RENT) complex;
ribonucleoprotein (RNP) complex; small subunit (SSU)
processome component; involved in rRNA processing |
Entry clone |
Cloned |
ORF length (unspliced) |
2574 |
ORF length (spliced) |
2403 |
Entry clone length |
2574 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1257G:A /
2204T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1B3.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGTTGGTTCATTGGA |
Rev primer name |
SPAC1B3.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCTGTGTTCAATGTAGCT |
Amino acid length |
800 |
Molecular weight |
88.3 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |