Gene name |
SPAC7D4.04 |
Gene ID |
29/D07 |
Gene synonyms/obsolete |
|
Gene product |
involved in response
to nitrogen starvation (required); involved in nitrogen
starvation-induced sexual development (required); involved in
G0 phase transition (required); interacts physically with
Taz1p; predicted coiled-coil region |
Entry clone |
Cloned |
ORF length (unspliced) |
2781 |
ORF length (spliced) |
|
Entry clone length |
2781 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2432A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC7D4.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTTTCGATTGAATGA |
Rev primer name |
SPAC7D4.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATCTTTCATCGATAGCT |
Amino acid length |
926 |
Molecular weight |
106.7 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVAWIMELNI |
Localization (YFP) |
cytoplasmic dots;
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |