Gene name |
SPBC146.14c |
Gene ID |
29/E06 |
Gene synonyms/obsolete |
sec26;
SPBC337.01c |
Gene product |
adaptin; coatomer
(beta subunit); the coatomer is a cytosolic protein complex
that binds to dilysine motifs and reversibly associates with
Golgi non- clathrin-coated vesicles, which further mediate
biosynthetic protein transport from the ER, via the Golgi up
to the trans Golgi network; Coatomer complex is required for
budding from Golgi membranes, and is essential for the
retrograde Golgi-to-ER transport of dilysine-tagged proteins
(By similarity) |
Entry clone |
Cloned |
ORF length (unspliced) |
2823 |
ORF length (spliced) |
|
Entry clone length |
2823 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC146.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTGTTGGACACTTGT |
Rev primer name |
SPBC146.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACAAATGCACCCAAGCTA |
Amino acid length |
940 |
Molecular weight |
104.6 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |