| Gene name |
SPACUNK4.16c |
| Gene ID |
29/E10 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl transferase
family 20; alpha,alpha-trehalose-phosphate synthase; involved
in the de-phosphoryulation of trehalose-6-phosphate to
trehalose and orthophosphate; similar to Sp SPAC22F8.05 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2835 |
| ORF length (spliced) |
|
| Entry clone length |
2835 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPACUNK4.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAGAATTTTAATAGC |
| Rev primer name |
SPACUNK4.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCGGAGTAAACTTTCTCA |
| Amino acid length |
944 |
| Molecular weight |
106.8 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFQRVPKLGI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |