| Gene name |
SPCC1739.14 |
| Gene ID |
29/G07 |
| Gene synonyms/obsolete |
npp106;
SPCC1739.14 |
| Gene product |
nuclear pore complex;
involved in nuclear import; involved in nuclear export;
involved in nuclear export of the small ribosomal subunit;
interacts physically with Rae1p (in mRNA export); similar to
Sp SPCC1739.14 (1others) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2964 |
| ORF length (spliced) |
2802 |
| Entry clone length |
2964 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1739.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCCAAGGAAGCCAA |
| Rev primer name |
SPCC1739.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAGAAGAGTCAGTTGCTCA |
| Amino acid length |
933 |
| Molecular weight |
105.7 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LREVGSNLPI/LQLIEHLDL |
| Localization (YFP) |
nuclear envelope;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|