| Gene name |
SPAC607.10 |
| Gene ID |
29/H12 |
| Gene synonyms/obsolete |
spo3 |
| Gene product |
involved in
sporulation (required); involved in prospore membrane
formation (required); expressed only during sporulation;
non-essential; no apparent orthologs; involved in ascospore
formation (required); essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3087 |
| ORF length (spliced) |
|
| Entry clone length |
3087 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
135A:G / 606C:T /
1274A:G / 1725A:G / 2196A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC607.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGATTTTGTCTGTCAT |
| Rev primer name |
SPAC607.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATAATGCGAGGTGGAAGG |
| Amino acid length |
1028 |
| Molecular weight |
119.4 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRILSLRI |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|