Gene name |
SPAC20G8.05c |
Gene ID |
30/A01 |
Gene synonyms/obsolete |
cdc15 |
Gene product |
phosphoprotein;
essential; involved in cytokinesis, septation,reorganization
of F-actin at mitosis; similar to Sp SPBC11C11.02 |
Entry clone |
Cloned |
ORF length (unspliced) |
3089 |
ORF length (spliced) |
2784 |
Entry clone length |
3089 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
2333G:T /
2476T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC20G8.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGTTAATGGAGTCTC |
Rev primer name |
SPAC20G8.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACCGTCTGAACAAAGTTC |
Amino acid length |
927 |
Molecular weight |
102.1 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |