| Gene name |
SPAC19A8.08 |
| Gene ID |
30/B05 |
| Gene synonyms/obsolete |
upf2 |
| Gene product |
involved in the
regulation of translation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3150 |
| ORF length (spliced) |
|
| Entry clone length |
3150 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
44A:T / 2360T:C /
2579T:C / 2846A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19A8.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAGAGAAGAACAAAT |
| Rev primer name |
SPAC19A8.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGAAGTTCAAAACCATT |
| Amino acid length |
1049 |
| Molecular weight |
122 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPSMVSLEL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |