Gene name |
SPAC688.11 |
Gene ID |
30/C09 |
Gene synonyms/obsolete |
|
Gene product |
actin cortical patch
component; ENTH domain protein; actin-binding protein;
involved in actin cytoskeletal organization, cell polarity,
endocytosis |
Entry clone |
Cloned |
ORF length (unspliced) |
3279 |
ORF length (spliced) |
|
Entry clone length |
3279 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1095A:G /
1361T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC688.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGTCAGACGCATCGTT |
Rev primer name |
SPAC688.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCTTCGGCAACATGATAA |
Amino acid length |
1092 |
Molecular weight |
123.1 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQLSKLQL |
Localization (YFP) |
cytoplasmic dots,
especially at cell tip and site of septum formation |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |