| Gene name |
SPCC1840.03 |
| Gene ID |
30/C10 |
| Gene synonyms/obsolete |
sal3; pse1 |
| Gene product |
importin beta;
armadillo repeat protein; HEAT repeat; Ran binding protein;
deletion mutant results in cell cycle delay; deletion mutant
results in mislocalization of Cdc25p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3288 |
| ORF length (spliced) |
|
| Entry clone length |
3288 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2814G:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1840.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAGTGGATTTCCTCC |
| Rev primer name |
SPCC1840.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAATGTGCAGACAAAGCT |
| Amino acid length |
1095 |
| Molecular weight |
121.8 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSRVLDMVLPL/LDDILQRLLTL/LPALFKMLEL |
| Localization (YFP) |
nuclear envelope;
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |