| Gene name |
SPAC6F12.16c |
| Gene ID |
30/D09 |
| Gene synonyms/obsolete |
|
| Gene product |
DEAD/DEAH box
helicase; ATP-dependent RNA helicase; involved in mRNA
export |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3354 |
| ORF length (spliced) |
|
| Entry clone length |
3354 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2569A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F12.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGTGGTGAGTTAGA |
| Rev primer name |
SPAC6F12.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAATATAGTGATGCACTA |
| Amino acid length |
1117 |
| Molecular weight |
126.1 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPQIEHILPL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |