| Gene name |
SPCC63.14 |
| Gene ID |
30/E07 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved in N.
crassa; predicted coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3555 |
| ORF length (spliced) |
|
| Entry clone length |
3555 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC63.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTACTCTTGGGAACTC |
| Rev primer name |
SPCC63.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAGTCTTCTTGGAAAGCG |
| Amino acid length |
1184 |
| Molecular weight |
131 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
725/724/1024 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery;
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |