Gene name |
SPAC890.06 |
Gene ID |
30/F01 |
Gene synonyms/obsolete |
|
Gene product |
nucleoporin; nuclear
pore complex |
Entry clone |
Cloned |
ORF length (unspliced) |
4055 |
ORF length (spliced) |
3948 |
Entry clone length |
4055 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
98A:G / 1744A:G /
2361T:C / 3078A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC890.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACATCAATGATCCATC |
Rev primer name |
SPAC890.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTATGTCTGACGAATTTCA |
Amino acid length |
1315 |
Molecular weight |
147.6 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIKEVTHLLKL |
Localization (YFP) |
cytoplasmic dots;
nuclear envelope |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |