| Gene name |
SPCC663.03 |
| Gene ID |
30/F04 |
| Gene synonyms/obsolete |
pmd1 |
| Gene product |
ABC transporter
family; leptomycin efflux transporter; homologous mammalian
P-glycoprotein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4089 |
| ORF length (spliced) |
|
| Entry clone length |
4089 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
240C:T / 334A:G /
515C:T / 866T:C / 2321A:G / 2365A:G / 2682T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC663.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTGCATAGTAAAAA |
| Rev primer name |
SPCC663.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTTTGTTCAATCCCTGT |
| Amino acid length |
1362 |
| Molecular weight |
149.6 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery with faint
ambiguous structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |