Gene name |
SPAC20G4.02c |
Gene ID |
30/F08 |
Gene synonyms/obsolete |
fus1 |
Gene product |
formin; involved in
conjugation with cellular fusion, actin cytoskeletal
organization; actin-binding protein; similar to Sp cdc12 and
for3 |
Entry clone |
Cloned |
ORF length (unspliced) |
4119 |
ORF length (spliced) |
|
Entry clone length |
4119 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1134A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC20G4.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGACGGCTAGTTTTAA |
Rev primer name |
SPAC20G4.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTCTTAAGTTCATTGTTA |
Amino acid length |
1372 |
Molecular weight |
157 |
Isoelectric point (calc.) |
8.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQFKESLRI/LKNIFDCLCL |
Localization (YFP) |
cytosol; cytoplasmic
dots; periphery at site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |