Gene name |
SPCC895.09c |
Gene ID |
30/G02 |
Gene synonyms/obsolete |
|
Gene product |
RNA helicase; similar
to pre-mRNA splicing factors at the C terminus; UBA domain
|
Entry clone |
Cloned |
ORF length (unspliced) |
4198 |
ORF length (spliced) |
3984 |
Entry clone length |
4198 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
1656T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC895.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTTCAAAAGGAAAAAA |
Rev primer name |
SPCC895.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACACCGTTGCCTGCAATC |
Amino acid length |
1327 |
Molecular weight |
149.8 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
784 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEDALEWLII/LQNIGSLLNI/LLTLLKLVI/LGEYLVSLPI/LIDPLGKGLIL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (cytosol>nucleus,
partially) |
Microscope used for
observation |
Leica |