| Gene name |
SPAC144.05 |
| Gene ID |
30/G08 |
| Gene synonyms/obsolete |
|
| Gene product |
zf-C3HC4 type;
ubiquitin ligase; SNF2 family; DEAD/DEAH box helicase;
involved in DNA repair; similar to Sp rad8 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4288 |
| ORF length (spliced) |
4128 |
| Entry clone length |
4288 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
1341T:G /
1479A:deletion / 4267G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC144.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCGAACTAAGAGGCG |
| Rev primer name |
SPAC144.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAATCCTCTGTGGTGAGC |
| Amino acid length |
1375 |
| Molecular weight |
159.9 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGLVLHHQLPI/LIHLMKLPL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |