| Gene name |
SPAC4F8.13c |
| Gene ID |
30/H04 |
| Gene synonyms/obsolete |
rng2 |
| Gene product |
IQGAP; RAS
GTPase-activating-like; non-essential; target RAS; IQ domains;
similar to S. cerevisiae YPL242C; required for
cytokinesis; component of the contractile F-actin ring;
required for its construction following assembly of F-actin at
the division site. |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4470 |
| ORF length (spliced) |
|
| Entry clone length |
4470 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1702T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4F8.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGTAAATGTGGGATT |
| Rev primer name |
SPAC4F8.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAATAAAATTTGGAGAAA |
| Amino acid length |
1489 |
| Molecular weight |
171.6 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDFEINPLTL/LDVLDGRLKL |
| Localization (YFP) |
cytoplasmic dots,
especially at site of septum formation; cytosol |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |