Gene name |
SPCC1919.10c |
Gene ID |
31/A01 |
Gene synonyms/obsolete |
myo52 |
Gene product |
class V myosin;
involved in cell polarity and cytokinesis; IQ domains; DIL
domain |
Entry clone |
Cloned |
ORF length (unspliced) |
4684 |
ORF length (spliced) |
4551 |
Entry clone length |
4684 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1919.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACATCGGGGATTTATTA |
Rev primer name |
SPCC1919.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACTTTAATACCATTTGGT |
Amino acid length |
1516 |
Molecular weight |
175.1 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |