Gene name |
SPAC343.11c |
Gene ID |
31/A04 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-C5HC2 type; jmjC domain; jmjN domain; similar to
retinoblastoma binding proteins; involved in transcriptional
regulation; overexpression supresseses chk1 mutant;
non-essential; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
4767 |
ORF length (spliced) |
|
Entry clone length |
4767 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
187A:G / 519A:G /
698T:C / 754T:C / 4198A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC343.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGAAAAATTCATCTCA |
Rev primer name |
SPAC343.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATGCTGAGGTATGTTTCA |
Amino acid length |
1588 |
Molecular weight |
180.3 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
845/844 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGKAVDLLQI/LKDRVDRELTL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |