| Gene name |
SPAC6G9.10c |
| Gene ID |
31/B03 |
| Gene synonyms/obsolete |
sen1 |
| Gene product |
DNA2/NAM7 family;
DEAD/DEAH box helicase; RNA helicase; tRNA-splicing
endonuclease positive effector; involved in tRNA splicing
& snRNA and snoRNA maturation; similar to Sp
SPBC29A10.10c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5064 |
| ORF length (spliced) |
|
| Entry clone length |
5064 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
4279T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G9.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGAGAATCTTAGCGA |
| Rev primer name |
SPAC6G9.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGATCGTTGTCTGATTTCT |
| Amino acid length |
1687 |
| Molecular weight |
192.5 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDALFDLLSL/LSFFPALRI/LLAKFDSLIL/LFSFIMWLKI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |