| Gene name |
SPAC26A3.05 |
| Gene ID |
31/B05 |
| Gene synonyms/obsolete |
chc1 |
| Gene product |
clathrin heavy
chain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5097 |
| ORF length (spliced) |
5001 |
| Entry clone length |
5097 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
523C:T / 976A:G /
3723A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26A3.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTCAACAATTACCAAT |
| Rev primer name |
SPAC26A3.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAATTACCAAGTCTTGGC |
| Amino acid length |
1666 |
| Molecular weight |
190 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPIRFSEVLQL/LRSNLRQNLQI/LAQICGLNL |
| Localization (YFP) |
cytoplasmic dots;
Golgi? |
| Comments for localization |
large bright dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |