Gene name |
SPBC3E7.01 |
Gene ID |
31/B10 |
Gene synonyms/obsolete |
fab1;
SPBC6B1.11c |
Gene product |
1-phosphatidylinositol-4-phosphate 5-kinase
activity; involved in signal transductionand conjugation; zinc
finger protein; zf-FYVE type; induced by nitrogen starvation;
non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
5799 |
ORF length (spliced) |
|
Entry clone length |
5799 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1362A:G / 3109T:C /
3790G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3E7.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAGTCGAAACGCC |
Rev primer name |
SPBC3E7.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCGCAAAACTTAAAACCT |
Amino acid length |
1932 |
Molecular weight |
220.1 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVRRFEELSL |
Localization (YFP) |
cytoplasmic dots;
ambiguous structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |