Gene name |
SPBP8B7.06 |
Gene ID |
31/D03 |
Gene synonyms/obsolete |
rpp201; rpp2;
rpp2-1 |
Gene product |
60s acidic ribosomal
protein (P2A subunit); similar to Sp SPBC23G7.15C and
SPAC1071.08 |
Entry clone |
Cloned |
ORF length (unspliced) |
396 |
ORF length (spliced) |
333 |
Entry clone length |
396 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP8B7.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTACCTTGCAGCTTA |
Rev primer name |
SPBP8B7.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTCGAAAAGACCGAAACCC |
Amino acid length |
110 |
Molecular weight |
11.1 |
Isoelectric point (calc.) |
3.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |