| Gene name |
SPBC32F12.09 |
| Gene ID |
31/G12 |
| Gene synonyms/obsolete |
rum1 |
| Gene product |
CDK inhibitor;
regulator of G1 phase progression; involved in pheromone
induced G1 arrest; functional ortholog of Sc SIC1; 2
transcripts; expression cell cycle dependent; phosphorylated
by MAPK |
| Entry clone |
Cloned |
| ORF length (unspliced) |
693 |
| ORF length (spliced) |
|
| Entry clone length |
693 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32F12.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACCTTCAACACCACC |
| Rev primer name |
SPBC32F12.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGTAATAAATTGTGCCTG |
| Amino acid length |
230 |
| Molecular weight |
25.2 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |