| Gene name |
SPBC36B7.07 |
| Gene ID |
31/H10 |
| Gene synonyms/obsolete |
tlg1 |
| Gene product |
SNARE; involved in
secretory pathway; GPI anchored protein; 1 predicted
transmembrane helix; Belongs to the syntaxin/epimorphin
family; Contains 1 t-SNARE coiled-coil homology domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
769 |
| ORF length (spliced) |
678 |
| Entry clone length |
769 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC36B7.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGACCCCTTTTATGA |
| Rev primer name |
SPBC36B7.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAGCACAATAACCAATACC |
| Amino acid length |
225 |
| Molecular weight |
24.9 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIIILIALLVL |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |