| Gene name |
SPAC8C9.08 |
| Gene ID |
31/H12 |
| Gene synonyms/obsolete |
rps5 |
| Gene product |
40S ribosomal protein
S5 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
828 |
| ORF length (spliced) |
612 |
| Entry clone length |
828 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC8C9.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACGTCGAGTCTCAC |
| Rev primer name |
SPAC8C9.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGGTTACTCTTGGCAACA |
| Amino acid length |
203 |
| Molecular weight |
22.2 |
| Isoelectric point (calc.) |
10.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRVNQALAL |
| Localization (YFP) |
cytosol; occasionally
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol |
| Microscope used for
observation |
Leica |