| Gene name |
SPBC2D10.10c |
| Gene ID |
32/B02 |
| Gene synonyms/obsolete |
fib1; fib |
| Gene product |
fibrillarin; U3 snoRNP
component; involved in rRNA processing and methylation; small
nuclear ribonucleoprotein (snRNP); involved in rRNA
processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
918 |
| ORF length (spliced) |
|
| Entry clone length |
918 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
721T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2D10.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATATACACCAGGTTC |
| Rev primer name |
SPBC2D10.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGATGTCTCAAGTATTTT |
| Amino acid length |
305 |
| Molecular weight |
32 |
| Isoelectric point (calc.) |
10.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
46/22/31 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleolus; spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleolus>nucleus; nuclear
dots) |
| Microscope used for
observation |
Leica |