Gene name |
SPBC725.11c |
Gene ID |
32/C08 |
Gene synonyms/obsolete |
php2 |
Gene product |
CCAAT-box binding
factor subunit; involved n growth on non-fermentable carbon
sources, transcriptional activation |
Entry clone |
Cloned |
ORF length (unspliced) |
1005 |
ORF length (spliced) |
|
Entry clone length |
1005 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
782A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC725.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCCATATGAGCCGGT |
Rev primer name |
SPBC725.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTCATGGTTCCTGAAGAA |
Amino acid length |
334 |
Molecular weight |
34.8 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
18/48 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; spindle
microtubules? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |