Gene name |
SPBP16F5.02 |
Gene ID |
32/E06 |
Gene synonyms/obsolete |
mcs2 |
Gene product |
cyclin; mitotic
catastrophe suppresso; transcription initiation factor TFIIH
subunit; interacts physically with Crk1p |
Entry clone |
Cloned |
ORF length (unspliced) |
1107 |
ORF length (spliced) |
969 |
Entry clone length |
1107 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP16F5.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCCGATAAATTTCG |
Rev primer name |
SPBP16F5.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCAAACGGATTTTTATCC |
Amino acid length |
322 |
Molecular weight |
37.6 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNALSSALSL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |