Gene name |
SPBC25D12.04 |
Gene ID |
32/E12 |
Gene synonyms/obsolete |
suc22 |
Gene product |
ribonucleotide
reductase; ribonucleotide-diphosphate reductase (small
subunit); involved in DNA replication (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1176 |
ORF length (spliced) |
|
Entry clone length |
1176 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
7C:T / 104T:C / 700T:C
/ 709T:G / 838A:G / 933T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC25D12.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCCTTGAGCATCTCGA |
Rev primer name |
SPBC25D12.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGTCCTCATCGATTGTA |
Amino acid length |
391 |
Molecular weight |
45.4 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |