| Gene name |
SPBC365.13c |
| Gene ID |
32/F04 |
| Gene synonyms/obsolete |
hba1; caf1 |
| Gene product |
Ran-GTPase-binding
protein; involved in brefeldin A resistance; involved in
nuclear export, oxidative stress response; interacts
genetically with crm1; deletion induces nucler accumulation of
pap1p and Sty1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1200 |
| ORF length (spliced) |
|
| Entry clone length |
1200 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
51T:C / 821A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC365.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCAGCAAAATGGAAAA |
| Rev primer name |
SPBC365.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCATCTTCTCTTCCACCC |
| Amino acid length |
399 |
| Molecular weight |
43.2 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |