| Gene name |
SPBC776.09 |
| Gene ID |
33/B08 |
| Gene synonyms/obsolete |
ste13 |
| Gene product |
DEAD/DEAH box
helicase; ATP-dependent; RNA helicase; involved in
nitrogen-starvation induced G1 arrest (required); involved in
conjugation (initiation) (required); involved in RNA
processing; involved in mRNA deadenylation-dependent decapping
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1555 |
| ORF length (spliced) |
1458 |
| Entry clone length |
1555 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
533A:G / 920T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC776.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGAAAGCTTGATTCA |
| Rev primer name |
SPBC776.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCTGCTTTTTGTTGACCA |
| Amino acid length |
485 |
| Molecular weight |
54.7 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNTLFSKLQI |
| Localization (YFP) |
cytoplasmic dots,
especially at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |