| Gene name |
SPBC1105.04c |
| Gene ID |
33/B10 |
| Gene synonyms/obsolete |
abp1; cbp1 |
| Gene product |
ARS binding protein;
binds to centromeric DNA sequences; involved in chromosome
segregation (mitotic) (required); involved in chromosome
segregation (meiotic); CENP-B homolog; no apparent Sc
ortholog; CENP-B box; C-terminal dimerization domain;
disruption of CENP-B homologs causes a decrease in
heterochromatin-specific modifications of histone H3; Sp
CENP-B homologs are functionally redundant at centromeres;
CENP-B homologs act as site-specific nucleation factors for
the formation of centromeric heterochromatin by
heterochromatin-specific modifications of histone tails |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1569 |
| ORF length (spliced) |
|
| Entry clone length |
1569 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
269A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1105.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAAAATCAAAAGAAG |
| Rev primer name |
SPBC1105.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTGCTTCTCAAACGAGAA |
| Amino acid length |
522 |
| Molecular weight |
59.8 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |