| Gene name |
SPBC887.10 |
| Gene ID |
33/B11 |
| Gene synonyms/obsolete |
mcs4 |
| Gene product |
mitotic catastrophe
suppressor; response regulator receiver domain; involved in
stress response; involved in cell cycle regulation;
Wik1-Wis1-Spc1 kinase cascade |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1569 |
| ORF length (spliced) |
|
| Entry clone length |
1569 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
216C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC887.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGCATTTGGTTTAAAAA |
| Rev primer name |
SPBC887.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGACCGCGAAAACGGCAC |
| Amino acid length |
522 |
| Molecular weight |
57.2 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
moving cytoplasmic
dots; periphery at site of septum formation? |
| Comments for localization |
moving dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |