Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPBC29B5.01
Gene ID 33/C12
Gene synonyms/obsolete atf1; mts1; sss1; gad7
Gene product transcription factor; involved in sexual development (required); involved in entry into stationary phase(required); involved in G1 arrest; involved in gene expression under nitrogen starvation (required); heterodimeric transcriptional activator; involved in meiotic recombination; binds M26 recombination hotspot; involved in oxidative stress response; target for the Sty1p stress-activated MAP kinase pathway; bZIP (basic leucine zipper) transcription factor family; overexpression suppresses calcium sensitivity of Atf1
Entry clone Cloned
ORF length (unspliced) 1701
ORF length (spliced)
Entry clone length 1701
No. of intron 0
Sequence status Finished
Sequence results 516T:C / 654T:C / 1283A:G / 1287T:C
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPBC29B5.01.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGTCCCCGTCTCCCGTCAA
Rev primer name SPBC29B5.01.Rv
Rev primer SEQ AGAAAGCTGGGTAGTACCCTAAATTGATTCTT
Amino acid length 566
Molecular weight 59.7
Isoelectric point (calc.) 5.7
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) none
Localization (YFP) nuclear dots; nucleus
Comments for localization large nuclear dots by over expression
Effect of LMB on protein localization no change
Microscope used for observation DeltaVision

Image information
YFP 3 images) See all images

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.