Gene name |
SPBC119.08 |
Gene ID |
33/D02 |
Gene synonyms/obsolete |
pmk1; spm1 |
Gene product |
serine/threonine
protein kinase; MAP kinase (MAPK); regulates cell integrity;
functions coordinately with the protein kinase C pathway;
stress-activated; regulates morphogenesis; involved in cell
wall biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
1724 |
ORF length (spliced) |
1269 |
Entry clone length |
1724 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
102A:deletion /
138G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC119.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCGTCGACATCGTGT |
Rev primer name |
SPBC119.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTATGGCGATTATCATCA |
Amino acid length |
422 |
Molecular weight |
48.2 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |