| Gene name |
SPBC1921.03c |
| Gene ID |
33/D08 |
| Gene synonyms/obsolete |
mex67 |
| Gene product |
involved in mRNA
export; interacts physically with Rae1p |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1791 |
| ORF length (spliced) |
|
| Entry clone length |
1791 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1921.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGCGTAGAAAGCGGGA |
| Rev primer name |
SPBC1921.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAAATGCTTCGGCTGGT |
| Amino acid length |
596 |
| Molecular weight |
66.5 |
| Isoelectric point (calc.) |
10.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPELQELVL/LLRSFDRTLLI |
| Localization (YFP) |
nucleus>>cytosol; spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |