| Gene name |
SPBP4H10.04 |
| Gene ID |
33/E08 |
| Gene synonyms/obsolete |
ppb1;
SPBC1346.01c |
| Gene product |
serine/threonine
protein phosphatase (2b catalytic subunit); calcineurin-like
protein; involved in cytokinesis (required); involved in cell
separation; involved in cell polarity; involved in
conjugation; involved in spindle pole body positioning;
coordinately regulates cytokinesis with Its3p; involved in
septation (required); expression peaks at M-G1 phase;
regulated by PBF transcription complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1863 |
| ORF length (spliced) |
1665 |
| Entry clone length |
1863 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
377T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP4H10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCGGGTCCTCATAA |
| Rev primer name |
SPBP4H10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAAGAGCTTTTCTTATCT |
| Amino acid length |
554 |
| Molecular weight |
63.7 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLYLWALKI/LQSFNALPL |
| Localization (YFP) |
cytosol; site of
septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |