| Gene name |
SPBC36B7.03 |
| Gene ID |
33/E11 |
| Gene synonyms/obsolete |
|
| Gene product |
localization SRP
receptor complex; SRP receptor activity; involved in
intracellular protein transport; involved in protein-ER
targeting; involved in SRP-dependent cotranslational membrane
targeting; DNAJ domain protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1946 |
| ORF length (spliced) |
1836 |
| Entry clone length |
1946 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1006T:C / 1231A:G /
1579A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC36B7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCTGAGTACAAGTA |
| Rev primer name |
SPBC36B7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTCCATCAGAAGTGTCA |
| Amino acid length |
611 |
| Molecular weight |
69.7 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDAPFPLLQL/LMEDVKNLSI |
| Localization (YFP) |
ER |
| Comments for localization |
accumulated ER around
nucleus by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |