| Gene name |
SPBC25D12.03c |
| Gene ID |
33/G03 |
| Gene synonyms/obsolete |
mcm7 |
| Gene product |
MCM complex subunit;
involved in DNA replication (initiation) (required);
essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2283 |
| ORF length (spliced) |
|
| Entry clone length |
2283 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
498A:G / 577G:A /
1039T:C / 1146T:C / 1570A:G / 1815T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC25D12.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACTTCCCACCATAGA |
| Rev primer name |
SPBC25D12.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTCTCCATATGTAAATCC |
| Amino acid length |
760 |
| Molecular weight |
85.6 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSRFDILFL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |