| Gene name |
SPBC8D2.05c |
| Gene ID |
33/H04 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in mitotic
spindle assembly; involved in chromosome condensation; spindle
pole body protein; centrin binding repeats; similar to S.
cerevisiae YLL003W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2578 |
| ORF length (spliced) |
2523 |
| Entry clone length |
2578 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
77A:G / 2273T:C /
2295T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC8D2.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAAAAATGGCGCTCC |
| Rev primer name |
SPBC8D2.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGGGTATTAGGAGGTATA |
| Amino acid length |
840 |
| Molecular weight |
102 |
| Isoelectric point (calc.) |
10.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRDLEILRL/LLDIKELSI |
| Localization (YFP) |
SPB;
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |