| Gene name |
SPBC1289.04c |
| Gene ID |
33/H12 |
| Gene synonyms/obsolete |
pob1 |
| Gene product |
involved in cell
polarity (maintenance) (required); involved in cellular
elongation (required); involved in cytokinesis; involved in
cell separation (required); essential; pleckstrin homology
domain; SAM domain (sterile alpha motif); src (SH3) homology
domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2811 |
| ORF length (spliced) |
2616 |
| Entry clone length |
2811 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
773T:C / 1894T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1289.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAGTCAGCGGTTCGT |
| Rev primer name |
SPBC1289.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTGCTTGCTTGATTTC |
| Amino acid length |
871 |
| Molecular weight |
93.7 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDSNVLKELNI |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
accumulated
localization by over expression |
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (periphery at cell tip and
site of septum formation; nucleus>>cytosol) |
| Microscope used for
observation |
DeltaVision |