Gene name |
SPBP23A10.13 |
Gene ID |
34/A02 |
Gene synonyms/obsolete |
orc4; orp4 |
Gene product |
origin recognition
complex (subunit 4); binds to replication origin DNA via
multiple AT-hooks; AAA family ATPase |
Entry clone |
Cloned in 2004
trial |
ORF length (unspliced) |
2919 |
ORF length (spliced) |
|
Entry clone length |
2919 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBP23A10.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTCATCCCCATTCAC |
Rev primer name |
SPBP23A10.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATATAACCTCCTTAAGCCAG |
Amino acid length |
972 |
Molecular weight |
108.6 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
101/200 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LREISRQLSI/LVKNLSLLEL |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |